Werden Adaptersequenzen an die Enden meiner Sequenzen angehängt?

Bei Adapter-On Gene Fragments werden universelle Adapter an den Enden jedes Fragments synthetisiert. Die Adapter weisen eine Länge von 21 bis 22 Nukleotiden auf. Fragmente mit diesen Adaptern sind mit einer Reihe von Assemblierungsmethoden kompatibel: Restriction Digestion/Ligation, Gateway, Golden Gate und TOPO-Klonierung.

Das Hinzufügen von Restriktionsstellen innerhalb der Adapter kann verwendet werden, um Adapter zu entfernen. Die TOPO-Klonierung ist erfolgreich, jedoch bleiben alle Adapter aktiviert. 

 

ADAPTERSEQUENZEN

  • Bestellungen, die vor dem 9. August 2021 eingehen, haben die folgenden Adaptersequenzen:
    • 5'-Adapter: GAAGTGCCATTCCGCCTGACCT
    • 3’-Adapter: AGGCTAGGTGGAGGCTCAGTG
    • 5’ – GAAGTGCCATTCCGCCTGACCT – insert – AGGCTAGGTGGAGGCTCAGTG – 3'

 

  • Bestellungen, die nach dem 9. August 2021 bis zum 1. November 2021 eingehen, haben die folgenden Adaptersequenzen:
    • 5'-Adapter: CCCCGTCACCTTTGGCTTATCAGT
    • 3’-Adapter: AGTGACATCTGGACGCTAAGACCG
    • 5’ – CCCCGTCACCTTTGGCTTATCAGT – Insert – AGTGACATCTGGACGCTAAGACCG – 3'

 

  • Bestellungen, die nach dem 2. November 2021eingehen, haben die folgenden Adaptersequenzen:
    • 5'-Adapter: CAATCCGCCCTCACTACAACCG
    • 3’-Adapter: CTACTCTGGCGTCGATGAGGGA
    • 5’ – CAATCCGCCCTCACTACAACCG – Insert – CTACTCTGGCGTCGATGAGGGA – 3'

 

*Adapter sind kurze Sequenzen, die jedem Ende des Fragments als Teil unseres Syntheseprozesses hinzugefügt werden. Genfragmente ohne diese Adapter können während des Bestellvorgangs hinzugefügt werden. 

Wenn Sie Fragen zu Ihrer Bestellung haben, kontaktieren Sie uns bitte unter [email protected]  

 

War dieser Artikel hilfreich?

Nein

Sie haben noch Fragen? Kontakt