Des séquences d’adaptateurs sont-elles ajoutées aux extrémités de mes séquences ?

Pour les Adapter-On Gene Fragments, des adaptateurs universels sont synthétisés sur les extrémités de chaque fragment. Les adaptateurs font 21 à 22 nucléotides de long. Les fragments comportant ces adaptateurs sont compatibles avec un certain nombre de méthodes d’assemblage, à savoir digestion/ligation par restriction, Gateway, Golden Gate et clonage TOPO.

Il est possible d’ajouter des sites de restriction dans les adaptateurs pour supprimer des adaptateurs. La méthode de clonage TOPO fonctionne, mais conserve les adaptateurs. 

 

SÉQUENCES D’ADAPTATEURS

  • Pour les commandes reçues avant le 9 août 2021, les séquences adaptatrices sont les suivantes :
    • Adaptateur 5' : GAAGTGCCATTCCGCCTGACCT
    • Adaptateur 3’ : AGGCTAGGTGGAGGCTCAGTG
    • 5’ – GAAGTGCCATTCCGCCTGACCT – insert – AGGCTAGGTGGAGGCTCAGTG – 3'

 

  • Pour les commandes reçues entre le 9 août 2021 et le 1er novembre 2021, les séquences adaptatrices sont les suivantes :
    • Adaptateur 5' : CCCCGTCACCTTTGGCTTATCAGT
    • Adaptateur 3’ : AGTGACATCTGGACGCTAAGACCG
    • 5‘ – CCCCGTCACCTTTGGCTTATCAGT – insert – AGTGACATCTGGACGCTAAGACCG – 3‘

 

  • Pour les commandes reçues après le 2 novembre 2021, les séquences adaptatrices sont les suivantes :
    • Adaptateur 5' : CAATCCGCCCTCACTACAACCG
    • Adaptateur 3’ : CTACTCTGGCGTCGATGAGGGA
    • 5‘ – CAATCCGCCCTCACTACAACCG – insert – CTACTCTGGCGTCGATGAGGGA – 3‘

 

*Les adaptateurs sont de courtes séquences ajoutées à chaque extrémité de l’insert dans le cadre de notre procédé de synthèse. Des fragments de gènes sans ces adaptateurs sont également disponibles lors du processus de commande. 

Si vous avez des questions concernant votre commande, veuillez nous contacter à l’adresse suivante [email protected]  

 

Cet article a-t-il été utile ?

Non

Vous avez d’autres questions ? Nous contacter