Genes
Oligo Pools
NGS
Variant Libraries
Synthetic Controls
Antibody Discovery
IVDR Solutions
Twist Bioscience HQ
681 Gateway Blvd
South San Francisco, CA 94080
Target Enrichment
Close
- Can I use Twist Universal Blockers with other adapters?
- What are the sequences of the Post-capture amplification primers in the NGS kit?
- What is the concentration of the amplification primers used in the post-enrichment PCR?
- Is there a maximum amount of DNA I can put into the hybridization? Can I add more than 1500 ng of DNA?
Can I use Twist Universal Blockers with other adapters?
Twist Universal Blockers are compatible with TruSeq®-style library kits from Illumina® with single and dual-indexing schemes, and various barcode/UMI lengths. For more information, download the Product Sheet for our Universal Blockers.
Still have questions? Contact Us
What are the sequences of the Post-capture amplification primers in the NGS kit?
The sequences of the Post-capture amplification primers in the NGS kit are:
P5 Primer: AATGATACGGCGACCACCGA
P7 Primer: CAAGCAGAAGACGGCATACGA
Still have questions? Contact Us
What is the concentration of the amplification primers used in the post-enrichment PCR?
The concentration of our primers is 10uM for each primer. The final primer concentration is 0.5uM in post-capture PCR.
Still have questions? Contact Us
Is there a maximum amount of DNA I can put into the hybridization? Can I add more than 1500 ng of DNA?
We recommend a maximum input of 4 ug of DNA for hybridization. Adding more DNA may reduce the efficiency of the blockers which would result in higher off-target reads.
Still have questions? Contact Us
Can I use Twist Universal Blockers with other adapters?
Twist Universal Blockers are compatible with TruSeq®-style library kits from Illumina® with single and dual-indexing schemes, and various barcode/UMI lengths. For more information, download the Product Sheet for our Universal Blockers.
Still have questions? Contact Us
What are the sequences of the Post-capture amplification primers in the NGS kit?
The sequences of the Post-capture amplification primers in the NGS kit are:
P5 Primer: AATGATACGGCGACCACCGA
P7 Primer: CAAGCAGAAGACGGCATACGA
Still have questions? Contact Us
What is the concentration of the amplification primers used in the post-enrichment PCR?
The concentration of our primers is 10uM for each primer. The final primer concentration is 0.5uM in post-capture PCR.
Still have questions? Contact Us
Is there a maximum amount of DNA I can put into the hybridization? Can I add more than 1500 ng of DNA?
We recommend a maximum input of 4 ug of DNA for hybridization. Adding more DNA may reduce the efficiency of the blockers which would result in higher off-target reads.
Still have questions? Contact Us
