Twist Bioscience HQ
681 Gateway Blvd
South San Francisco, CA 94080
General
Can DNA purification beads 100322, 100584, 100395, 100591, and 100772 be used interchangeably?
Yes, they are the same beads, just different fill volumes.
Still have questions? Contact Us
What is the shelf life of the Twist NGS kits?
Twist Bioscience guarantees kits for a minimum of 3 months from the date of shipment.
Still have questions? Contact Us
Where can I find an MSDS for your product?
Safety Data Sheets can be downloaded from our web page, here.
Note that we only have SDS documents for NGS products on our web page; for SDS documents for our Synthetic Biology products, please email us at customersupport@twistbioscience.com.
Still have questions? Contact Us
What are the sequences of the adapters (for adapter trimming)?
For combinatorial and unique dual index adapters, the following sequences are used for adapter trimming: Read 1: AGATCGGAAGAGCACACGTCTGAACTCCAGTCA Read 2: AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
Still have questions? Contact Us
Can DNA purification beads 100322, 100584, 100395, 100591, and 100772 be used interchangeably?
Yes, they are the same beads, just different fill volumes.
Still have questions? Contact Us
What is the shelf life of the Twist NGS kits?
Twist Bioscience guarantees kits for a minimum of 3 months from the date of shipment.
Still have questions? Contact Us
Where can I find an MSDS for your product?
Safety Data Sheets can be downloaded from our web page, here.
Note that we only have SDS documents for NGS products on our web page; for SDS documents for our Synthetic Biology products, please email us at customersupport@twistbioscience.com.
Still have questions? Contact Us
What are the sequences of the adapters (for adapter trimming)?
For combinatorial and unique dual index adapters, the following sequences are used for adapter trimming: Read 1: AGATCGGAAGAGCACACGTCTGAACTCCAGTCA Read 2: AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
Still have questions? Contact Us