Can DNA purification beads 100322, 100584, 100395, 100591, and 100772 be used interchangeably?

Yes, they are the same beads, just different fill volumes.


Still have questions? Contact Us

What is the shelf life of the Twist NGS kits?

Twist Bioscience guarantees kits for a minimum of 3 months from the date of shipment. 


Still have questions? Contact Us

Where can I find an MSDS for your product?

Safety Data Sheets can be downloaded from our web page, here. 

Note that we only have SDS documents for NGS products on our web page; for SDS documents for our Synthetic Biology products, please email us at customersupport@twistbioscience.com.


Still have questions? Contact Us

What are the sequences of the adapters (for adapter trimming)?

For combinatorial and unique dual index adapters, the following sequences are used for adapter trimming: Read 1: AGATCGGAAGAGCACACGTCTGAACTCCAGTCA Read 2: AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT


Still have questions? Contact Us

Can DNA purification beads 100322, 100584, 100395, 100591, and 100772 be used interchangeably?

Yes, they are the same beads, just different fill volumes.


Still have questions? Contact Us

What is the shelf life of the Twist NGS kits?

Twist Bioscience guarantees kits for a minimum of 3 months from the date of shipment. 


Still have questions? Contact Us

Where can I find an MSDS for your product?

Safety Data Sheets can be downloaded from our web page, here. 

Note that we only have SDS documents for NGS products on our web page; for SDS documents for our Synthetic Biology products, please email us at customersupport@twistbioscience.com.


Still have questions? Contact Us

What are the sequences of the adapters (for adapter trimming)?

For combinatorial and unique dual index adapters, the following sequences are used for adapter trimming: Read 1: AGATCGGAAGAGCACACGTCTGAACTCCAGTCA Read 2: AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT


Still have questions? Contact Us