Quelles sont les séquences d’adaptateurs utilisées sur les Adapter-On Gene Fragments ?

  • Pour les commandes reçues avant le 9 août 2021, les séquences adaptatrices sont les suivantes :
    • Adaptateur 5' : GAAGTGCCATTCCGCCTGACCT
    • Adaptateur 3’ : AGGCTAGGTGGAGGCTCAGTG
    • 5’ – GAAGTGCCATTCCGCCTGACCT – insert – AGGCTAGGTGGAGGCTCAGTG – 3'

 

  • Pour les commandes reçues entre le 9 août 2021 et le 1er novembre 2021, les séquences adaptatrices sont les suivantes :
    • Adaptateur 5' : CCCCGTCACCTTTGGCTTATCAGT
    • Adaptateur 3’ : AGTGACATCTGGACGCTAAGACCG
    • 5‘ – CCCCGTCACCTTTGGCTTATCAGT – insert – AGTGACATCTGGACGCTAAGACCG – 3‘

 

  • Pour les commandes reçues après le 2 novembre 2021, les séquences adaptatrices sont les suivantes :
    • Adaptateur 5' : CAATCCGCCCTCACTACAACCG
    • Adaptateur 3’ : CTACTCTGGCGTCGATGAGGGA
    • 5‘ – CAATCCGCCCTCACTACAACCG – insert – CTACTCTGGCGTCGATGAGGGA – 3‘

 

*Les adaptateurs sont de courtes séquences ajoutées à chaque extrémité de l’insert dans le cadre de notre procédé de synthèse. Des fragments de gènes sans ces adaptateurs sont également disponibles lors du processus de commande.

Si vous avez des questions concernant votre commande, veuillez nous contacter à l’adresse suivante [email protected]

Cet article a-t-il été utile ?

Non

Vous avez d’autres questions ? Nous contacter