Welche Adaptersequenzen werden auf den Adapter-On Gene Fragments verwendet?

  • Bestellungen, die vor dem 9. August 2021 eingehen, haben die folgenden Adaptersequenzen:
    • 5'-Adapter: GAAGTGCCATTCCGCCTGACCT
    • 3’-Adapter: AGGCTAGGTGGAGGCTCAGTG
    • 5’ – GAAGTGCCATTCCGCCTGACCT – insert – AGGCTAGGTGGAGGCTCAGTG – 3'

 

  • Bestellungen, die nach dem 9. August 2021 bis zum 1. November 2021 eingehen, haben die folgenden Adaptersequenzen:
    • 5'-Adapter: CCCCGTCACCTTTGGCTTATCAGT
    • 3’-Adapter: AGTGACATCTGGACGCTAAGACCG
    • 5’ – CCCCGTCACCTTTGGCTTATCAGT – Insert – AGTGACATCTGGACGCTAAGACCG – 3'

 

  • Bestellungen, die nach dem 2. November 2021eingehen, haben die folgenden Adaptersequenzen:
    • 5'-Adapter: CAATCCGCCCTCACTACAACCG
    • 3’-Adapter: CTACTCTGGCGTCGATGAGGGA
    • 5’ – CAATCCGCCCTCACTACAACCG – Insert – CTACTCTGGCGTCGATGAGGGA – 3'

 

*Adapter sind kurze Sequenzen, die jedem Ende des Fragments als Teil unseres Syntheseprozesses hinzugefügt werden. Genfragmente ohne diese Adapter können während des Bestellvorgangs hinzugefügt werden.

Wenn Sie Fragen zu Ihrer Bestellung haben, kontaktieren Sie uns bitte unter [email protected]

War dieser Artikel hilfreich?

Nein

Sie haben noch Fragen? Kontakt