The Power of Silicon-based DNA Synthesis

Twist Bioscience’s high precision, silicon-based high-throughput gene synthesis platform enables us to produce high quality gene fragments starting at 7¢ (USD) per bp and NGS-verified sequence perfect clonal genes starting at 9¢ (USD) per bp. What does this mean for you? Rapid and accurate DNA synthesis at the scale you need for the price you want.

What Do We Offer?

Twist's Genes offering gives you the flexibility to get the DNA you want, the way you want it. Think bigger, expand your design scope, and accelerate discovery. Still not convinced? Talk to one of our resident experts!

How It Works

Normally, genes are synthesized with one gene per 96 well plate. Here at Twist, we have perfected gene synthesis and with our proprietary platform is able to synthesize 9600 genes per one silicon-based chip in a single run. This means we can produce 1 gene or 100,000 genes in parallel, in the same amount of time.

Get your genes faster than ever without compromising sequence integrity or quality with Twist Bioscience. Here’s what to do next:

All you have to do is design your custom sequence and our high quality gene synthesis platform will do the rest.

For Research Use Only. Not for Diagnostic Procedures.
 

* Calculated Twist internal data using Dr. Oligo benchmark January 2021 and validated by SRI Quality System Registrar and Silinnov Consulting in 2023

* This tool is therefore provided strictly for illustrative purposes and the stated benefits, support, benefit calculations and other results are estimates only, and this  estimate does not constitute a proposal or quote.

* This tool is therefore provided strictly for illustrative purposes and the stated benefits, support, benefit calculations, and other results are estimates only.

**Comparison to competitor’s publicly listed pricing as of July 12, 2024. Turnaround times between Twist and competitors may vary.

Testimonials

 

Clonal Genes

Twist Bioscience’s platform is capable of synthesizing hundreds of thousands of genes each month to meet all your DNA needs. Our silicon-based platform for DNA synthesis enables us to create at scale, highly precise, sequence perfect clonal genes of various lengths and difficulty that are all NGS verified and now produced faster than ever before. We are excited to announce our new Express Genes service, which provides you with NGS-verified Clonal Genes, shipped in as few as 4 days.* Learn More.

icon Our Express Genes service

Twist Bioscience’s Express Genes service provides you with the same NGS-verified, sequence perfect Clonal Genes you would expect from our standard Clonal Genes but with the added bonus of an all time fast order to ship turnaround time of 4-7 business days.

See below for our full Clonal Genes offering:

express gene service tables

Get express DNA today

× Zoomed Image

BENEFITS

Low Cost – High Quality

 
  • From 9¢ (USD) per bp
  • No hidden sub-cloning or DNA complexity fees
  • From 10 business days
  • Manufactured in the USA

DNA Your Way

 
  • 0.3 – 5 kb genes cloned into a plasmid of your choice
  • Choose a Twist Catalog Vector or send us yours
  • 4 prep scales (50ng – 2µg | 2µg – 10µg | 10µg – 100µg | 100µg – 1mg)
  • Normalization and endotoxin free options available

Scalable Synthesis

 
  • No order limits
  • Same turnaround regardless of order size

Sustainability

 
  • Significantly lower CO2e emissions than the industry standard
  • Twist DNA genes help our customers achieve their own climate change pledges and commitments
  • Twist DNA genes help customers reduce their GHG emissions

Data

Sequence Perfect Clonal Genes

A graphical representation of our standard NGS-verification performed on every clonal gene. The clonal gene in this figure is an example of an error-free clone. The read depth is indicated for the entire plasmid and no SNPs or indels were detected.


*Terms and Conditions: Eligible Express Genes ship in 4-7 business days. This time will vary based on complexity and length of the sequence. Orders placed outside of the US will incur additional delivery turnaround time. Turnaround time for Clonal Genes is subject to change based on customizations and complexity. Average turnaround time for Clonal Genes is 10 business days. New vector onboarding for both Express Genes and Clonal Genes will add additional time. Pricing calculator only refers to Gene Fragments and Clonal Genes offering, not inclusive of Express Genes service pricing.

For Research Use Only. Not for Diagnostic Procedures.

FAQ

Yes, there is an additional charge of $10 per gene.

You can find the pricing table for Clonal Gene products in your account by clicking here.

If you need to contact your Account Manager regarding pricing, their contact information is available in eCommerce under .

Twist can clone gene synthesis products of up to 5,000 bp into any of our catalog vectors. We also offer cloning into your own custom vector.

No - at this time, Twist does not have vectors for expression in plants; however, we can onboard a custom vector as long as it meets our requirements.

Certificates of Analysis (COA) are available for completed orders. You can find the COA for Clonal Gene products in your account by clicking here.
 

* This tool is therefore provided strictly for illustrative purposes and the stated benefits, support, benefit calculations, and other results are estimates only.

**Comparison to competitor’s publicly listed pricing as of July 12, 2024. Turnaround times between Twist and competitors may vary.

Using AI and clonal genes to design proteins that inhibit a pathogen’s ability to steal iron from blood

Join Dr. Rhys Grinter of the University of Melbourne to learn how AI/ML and Twist Clonal Genes enable rapid design and screening of protein binders that block bacterial heme-piracy.

Gene Fragments

DNA is the cornerstone of molecular biology, but working with poor-quality DNA wastes valuable time and resources. Twist Gene Fragments offer affordable, reliable, fast gene synthesis without hidden costs. By minimizing the need for colony screening with our 1:7500 error rate, our Gene Fragments help streamline cloning workflows, saving you resources downstream.


Order Now or Get the Product Sheet.

BENEFITS

Fast and Economical

 
  • From 7c (USD) per bp
  • No hidden costs
  • Shipped in 2-4 business days*
  • Manufactured in the USA

Built for Your Workflow

 
  • Length: 300 bp - 5000 bp
  • Yield: 100 ng - 1 µg
  • Industry leading error rate of 1:7500

DNA Your Way

 
  • Customization does not impact cost or shipping time.
  • Add amplification adapters for single primer set amplification
  • Choose between delivery in tubes or plates
  • Options for resuspension in buffer and normalization
  • No order minimums or maximums

Sustainability

 
  • Significantly lower CO2e emissions than the industry standard
  • Twist DNA genes help our customers achieve their own climate change pledges and commitments
  • Twist DNA genes help customers reduce their GHG emissions

Data

Twist’s DNA synthesis technology outperforms the competition with exceptionally low error rates.

In a direct comparison of Gene Fragment products, Twist consistently showed the lowest error rate. The graph to the left represents the average error rate for Gene sequences ordered from Twist and Integrated DNA Technologies, Inc. (IDT). The results show Twist Gene Fragments have greater sequence accuracy over eBlocks and gBlocks with an average of 2-fold greater accuracy in sequence fidelity for Twist Gene Fragments over gBlocks.

More perfect Genes from Twist

Twist Gene Fragments consistently yield the highest percentage of perfect clones which saves you time and money in your research. The graph to the left shows a direct comparison of the percentage of sequence perfect clones across a wide variety of gene lengths and sequences for 3 different gene products. Data was generated using a set of 63 sequences with a wide variety of gene lengths to reflect the diversity of gene lengths required for various real-world synthetic biology applications.

*This timeframe refers to the typical processing and handling time within our facilities before your order is handed over the shipping carrier.

FAQ

You can find the pricing table for Gene Fragment products in your account by clicking here.

If you need to contact your Account Manager regarding pricing, their contact information is available in eCommerce under .

You can use the following methods to clone gene fragments with adapters:

Restriction digestion/Ligation - place restriction sites inside of the Twist adapters for easy cloning

Type IIS or Golden Gate - place restriction sites inside of the Twist adapters for easy cloning TOPO cloning (blunt-end) - the adapter sequences will be cloned in as well

Gateway cloning - add attB sites to the ends of your sequence

For more information, click here.

For Adapter-On Gene Fragments, universal adapters are synthesized onto the ends of each fragment. The adapters are 21-22 nucleotides in length. Fragments with these adapters are compatible with a number of assembly methods, namely Restriction Digestion/Ligation, Gateway, Golden Gate, and TOPO cloning.

The addition of restriction sites inside of the adapters can be used to remove adapters. TOPO cloning will work but will leave the adapters on. 
ADAPTER SEQUENCES

  • For orders received before August 9, 2021, the adapter sequences are as follows:
    • 5' Adapter: GAAGTGCCATTCCGCCTGACCT
    • 3' Adapter: AGGCTAGGTGGAGGCTCAGTG
    • 5’ – GAAGTGCCATTCCGCCTGACCT – insert – AGGCTAGGTGGAGGCTCAGTG – 3'

 

  • For orders received after August 9, 2021 to November 1, 2021, the adapter sequences are as follows:
    • 5' Adapter: CCCCGTCACCTTTGGCTTATCAGT
    • 3' Adapter: AGTGACATCTGGACGCTAAGACCG
    • 5’ - CCCCGTCACCTTTGGCTTATCAGT – insert – AGTGACATCTGGACGCTAAGACCG - 3'

 

  • For orders received after November 2, 2021, the adapter sequences are as follows:
    • 5' Adapter: CAATCCGCCCTCACTACAACCG
    • 3' Adapter: CTACTCTGGCGTCGATGAGGGA
    • 5’ - CAATCCGCCCTCACTACAACCG – insert – CTACTCTGGCGTCGATGAGGGA - 3'

 

*Adapters are short sequences added to each end of the insert as part of our synthesis process. Gene fragments without these adapters are also available during the checkout process. 

If you have any questions about your order, please contact us at customersupport@twistbioscience.com

 

 

Yes, gene fragments go through a bead-based clean up; however, short fragments can carry over in small quantities.

  • For orders received before August 9, 2021, the adapter sequences are as follows:
    • 5' Adapter: GAAGTGCCATTCCGCCTGACCT
    • 3' Adapter: AGGCTAGGTGGAGGCTCAGTG
    • 5’ – GAAGTGCCATTCCGCCTGACCT – insert – AGGCTAGGTGGAGGCTCAGTG – 3'

 

  • For orders received after August 9, 2021 to November 1, 2021, the adapter sequences are as follows:
    • 5' Adapter: CCCCGTCACCTTTGGCTTATCAGT
    • 3' Adapter: AGTGACATCTGGACGCTAAGACCG
    • 5’ - CCCCGTCACCTTTGGCTTATCAGT – insert – AGTGACATCTGGACGCTAAGACCG - 3'

 

  • For orders received after November 2, 2021, the adapter sequences are as follows:
    • 5' Adapter: CAATCCGCCCTCACTACAACCG
    • 3' Adapter: CTACTCTGGCGTCGATGAGGGA
    • 5’ - CAATCCGCCCTCACTACAACCG – insert – CTACTCTGGCGTCGATGAGGGA - 3'

 

*Adapters are short sequences added to each end of the insert as part of our synthesis process. Gene fragments without these adapters are also available during the checkout process.


If you have any questions about your order, please contact us at customersupport@twistbioscience.com

* This tool is therefore provided strictly for illustrative purposes and the stated benefits, support, benefit calculations, and other results are estimates only.

**Comparison to competitor’s publicly listed pricing as of July 12, 2024. Turnaround times between Twist and competitors may vary.

How Resurrect Bio are powering AI guided plant trait discovery with Clonal Genes and Gene Fragments

Dr. Binnian of Resurrect Bio shares how her team uses AI-driven gene design and Twist Genes to tackle plant immunity challenges, rapidly screening thousands of sequences from in silico prediction to in planta validation.

Clonal Genes Product Sheet

Twist Bioscience is transforming gene synthesis, a process at the core of synthetic and molecular biology. Our silicon-based DNA writing platform significantly increases gene synthesis throughput and scalability, while also reducing turnaround time and price per base.

 

Gene Fragments Product Sheet

Twist Bioscience gene fragments improve your cloning process by minimizing colony screening. This allows you to save time and money by dramatically reducing cloning and sequencing costs.

Build a better DNA Assembly Line
Arzeda leverages technology from Labcyte, TeselaGen and Twist Bioscience to accelerate their synthetic biology workflow.
Speeding Up Antibody Discovery for Infectious Disease
Tasked with an ambitious goal from DARPA to develop a rapid response to help medical workers fight viral diseases in the field, Vanderbilt University Medical Center has already reduced the time to develop antibodies significantly. High-throughput, synthetic genes from Twist Bioscience have allowed the lab to expedite this process.

Pathway Engineering Through 5 kb Gene Synthesis
A rapid design-build-test cycle is vital to metabolic engineering applications in which researchers re-program microorganisms to produce non-native molecules of interest. To produce these molecules, researchers typically add one gene or an entire pathway of genes into a host organism. These genes encode proteins or enzymes that, when expressed in a microbial host, convert a common substrate into a molecule of interest.
Twist Tips for Genes: How to Design Your Gene
Twist Bioscience uses a silicon-based DNA synthesis platform to generate… high-quality synthetic DNA. Designing and ordering genes from Twist Bioscience is simple when using our online ordering platform. This document provides tips for optimizing and customizing Twist Clonal Genes and Gene Fragments for a variety of applications
Twist Tips for Genes - Meeting Minimum Length Requirements for Genes in Custom Vectors
When you submit a sequence for synthesis, the scoring algorithm checks the sequence to determine whether it can be synthesized, and one of the first things it checks is whether the sequence meets the minimum length requirement of 300 bp. Use this document to help you design your Genes when they do not meet the minimum length requirement.
From Design to Protein: Cell-Free Protein Expression Using Twist Gene Fragments

Amyris discusses Next-Generation Platforms for Strain Optimization 
Watch this webinar showing how Twist Genes are enabling this innovative company with their microbial engineering efforts.https://www.twistbioscience.com/genes_bioengineeringwebinar_sunilchandran

Twist DNA Resuspension Guidelines
DOWNLOAD
Gene Fragments Cloning Guidelines
Twist Bioscience's Gene Fragments are double-stranded DNA, 300 to… 5000 base pairs in length. These high-quality fragments come with unique 5’ and 3’ adapter sequences.
Twist Glycerol Stocks Handling Instructions

* This tool is therefore provided strictly for illustrative purposes and the stated benefits, support, benefit calculations, and other results are estimates only.

**Comparison to competitor’s publicly listed pricing as of July 12, 2024. Turnaround times between Twist and competitors may vary.

Broad-spectrum anti-CRISPR proteins facilitate horizontal gene transfer
Machine Learning-Guided Prediction of Antigen-Reactive In Silico Clonotypes Based on Changes in Clonal Abundance through Bio-Panning
Crystal structure of Nsp15 endoribonuclease NendoU from SARS-CoV-2
Continuous evolution of SpCas9 variants compatible with non-G PAMs
Convergent selection in antibody repertoires is revealed by deep learning
The LRRC8A:C Heteromeric Channel Is a cGAMP Transporter and the Dominant cGAMP Importer in Human Vasculature Cells
De novo protein design enables precise induction of functional antibodies in vivo
In situ readout of DNA barcodes and single base edits facilitated by in vitro transcription
A bottom-up approach for the de novo design of functional proteins

* This tool is therefore provided strictly for illustrative purposes and the stated benefits, support, benefit calculations, and other results are estimates only.

**Comparison to competitor’s publicly listed pricing as of July 12, 2024. Turnaround times between Twist and competitors may vary.

General

Twist Bioscience attests that the company adheres to all requirements in the U.S. Office of Science and Technology Policy (OSTP)  Framework for Nucleic Acid Synthesis Screening.
Download the attestation here.

Twist Bioscience ships its DNA products dried down or resuspended in 2 mL microcentrifuge tubes, 96-well plates, or 384-well plates. Dried DNA is shipped at ambient temperature and resuspended DNA is shipped frozen.

Double-stranded DNA and single-stranded oligonucleotides are stable under most standard laboratory storage conditions. However, it is important to consider the following best practices to maintain the high quality of the DNA synthesized by Twist Bioscience.

  • Twist recommends storing Dried DNA for the following durations based on storage condition.
    • Room Temperature for 3 months.
    • 4° C for 12 months.
    • -20° C for 24 months.
    • -80° C for long term storage.
  • Resuspension Guidelines
    • For resuspension, briefly centrifuge the tube or plate before opening and resuspend in nuclease free Tris-EDTA (TE) buffer, pH 8.0 or 10 mM Tris-HCl, pH 8.0 to the desired concentration.
    • A concentration of at least 10 ng/μL is recommended for the stock dilution, but the optimal concentration will need to be determined based on your desired application.
    • Prepare aliquots of the stock dilution and separate working aliquots to limit chances of contamination and to reduce the number of freeze/thaw cycles. Use working aliquots as soon as possible after preparation and minimize exposure to high temperatures.
  • Resuspended DNA
    • Resuspension is available for some products. Your DNA may arrive in one of the following buffers. We recommend briefly centrifuging the tube or plate before opening.
      • Elution buffer (2 mM Tris-Cl, pH 8.5)
      • TE buffer (10 mM Tris-Cl pH 8.0, 1 mM EDTA)
      • TE Buffer low EDTA (10 mM Tris-Cl pH 8.0, 0.1 mM EDTA)
      • Water       
        • We do not recommend long-term storage in water.
    • Twist recommends storing Resuspended DNA for the following durations based on storage condition.
      • Room Temperature for 3 months.
      • 4° C for 12 months.
      • -20° C for 24 months.
      • -80° C for long term storage.

All of our Clonal Gene synthesis products are NGS sequence verified.

Gene Fragments are not NGS verified. With a low error rate for gene synthesis, we estimate that you will need to sequence approximately 3, 4, or 6 colonies for Gene Fragments of 600, 1200, or 1800 bps respectively to obtain a sequence perfect clone with 99% confidence.

Gene products are typically delivered as a dried-down product (unless otherwise specified).

Clonal Genes are delivered cloned into one Twist's catalog vectors or your own custom vector. Gene Fragments are delivered as linear, double stranded sequences (with or without flanking adapters).

We deliver the gene sequences in 96/384-well plates. For small orders (less than 10), the genes can be delivered in tubes at no additional cost. For orders with 10 or more genes, tube order requests are an additional $50 per order.

Twist DNA products are dried down and shipped in either 96/384-well plates or 2 ml microcentrifuge tubes. Although double-stranded DNAs are stable under most standard storage conditions, we recommend the following to maintain high quality DNA:

  • Upon receipt, briefly centrifuge tube or plate and resuspend the DNA in nuclease free Tris-EDTA (TE) buffer, pH 8.0 or 10 mM Tris-HCl, pH 8.0 to the desired concentration.
  • We do not recommend resuspension in water.
  • A concentration of at least 10 ng/ul is recommended for a stock solution, but optimal concentration will need to be determined based on your desired application.
  • Prepare aliquots of the stock and separate working aliquots to limit the chances of contamination and reduce the number of freeze/thaw cycles.
  • For long term storage, freeze DNA at -20° C for up to one year, or at -80° C for even longer storage.

Resuspension guideline can be found here

Clonal Genes

You can find the pricing table for Gene Fragment products in your account by clicking here.

If you need to contact your Account Manager regarding pricing, their contact information is available in eCommerce under .

You can use the following methods to clone gene fragments with adapters:

Restriction digestion/Ligation - place restriction sites inside of the Twist adapters for easy cloning

Type IIS or Golden Gate - place restriction sites inside of the Twist adapters for easy cloning TOPO cloning (blunt-end) - the adapter sequences will be cloned in as well

Gateway cloning - add attB sites to the ends of your sequence

For more information, click here.  

For Adapter-On Gene Fragments, universal adapters are synthesized onto the ends of each fragment. The adapters are 21-22 nucleotides in length. Fragments with these adapters are compatible with a number of assembly methods, namely Restriction Digestion/Ligation, Gateway, Golden Gate, and TOPO cloning.

The addition of restriction sites inside of the adapters can be used to remove adapters. TOPO cloning will work but will leave the adapters on. 
ADAPTER SEQUENCES

  • For orders received before August 9, 2021, the adapter sequences are as follows:
    • 5' Adapter: GAAGTGCCATTCCGCCTGACCT
    • 3' Adapter: AGGCTAGGTGGAGGCTCAGTG
    • 5’ – GAAGTGCCATTCCGCCTGACCT – insert – AGGCTAGGTGGAGGCTCAGTG – 3'

 

  • For orders received after August 9, 2021 to November 1, 2021, the adapter sequences are as follows:
    • 5' Adapter: CCCCGTCACCTTTGGCTTATCAGT
    • 3' Adapter: AGTGACATCTGGACGCTAAGACCG
    • 5’ - CCCCGTCACCTTTGGCTTATCAGT – insert – AGTGACATCTGGACGCTAAGACCG - 3'

 

  • For orders received after November 2, 2021, the adapter sequences are as follows:
    • 5' Adapter: CAATCCGCCCTCACTACAACCG
    • 3' Adapter: CTACTCTGGCGTCGATGAGGGA
    • 5’ - CAATCCGCCCTCACTACAACCG – insert – CTACTCTGGCGTCGATGAGGGA - 3'

 

*Adapters are short sequences added to each end of the insert as part of our synthesis process. Gene fragments without these adapters are also available during the checkout process. 

If you have any questions about your order, please contact us at customersupport@twistbioscience.com

Yes, gene fragments go through a bead-based clean up; however, short fragments can carry over in small quantities.

  • For orders received before August 9, 2021, the adapter sequences are as follows:
    • 5' Adapter: GAAGTGCCATTCCGCCTGACCT
    • 3' Adapter: AGGCTAGGTGGAGGCTCAGTG
    • 5’ – GAAGTGCCATTCCGCCTGACCT – insert – AGGCTAGGTGGAGGCTCAGTG – 3'

 

  • For orders received after August 9, 2021 to November 1, 2021, the adapter sequences are as follows:
    • 5' Adapter: CCCCGTCACCTTTGGCTTATCAGT
    • 3' Adapter: AGTGACATCTGGACGCTAAGACCG
    • 5’ - CCCCGTCACCTTTGGCTTATCAGT – insert – AGTGACATCTGGACGCTAAGACCG - 3'

 

  • For orders received after November 2, 2021, the adapter sequences are as follows:
    • 5' Adapter: CAATCCGCCCTCACTACAACCG
    • 3' Adapter: CTACTCTGGCGTCGATGAGGGA
    • 5’ - CAATCCGCCCTCACTACAACCG – insert – CTACTCTGGCGTCGATGAGGGA - 3'

 

*Adapters are short sequences added to each end of the insert as part of our synthesis process. Gene fragments without these adapters are also available during the checkout process.


If you have any questions about your order, please contact us at customersupport@twistbioscience.com

Codon Optimization

Here is a list of organisms that are supported for codon optimization on our website:

  • Arabidopsis thaliana
  • Aspergillus niger
  • Aspergillus oryzae
  • Bacillus subtilis
  • Brassica napus
  • Caenorhabditis elegans
  • Cricetulus griseus (CHO)
  • Drosophila melanogaster
  • Escherichia coli
  • Glycine max
  • Homo sapiens
  • Hypocrea jecorina
  • Medicago sativa
  • Mus musculus
  • Nicotiana tabacum
  • Petunia x hybrida
  • Pichia pastoris
  • Pisum sativum
  • Rattus norvegicus
  • Saccharomyces cerevisiae
  • Solanum tuberosum
  • Spodoptera frugiperda
  • Streptomyces coelicolor A3(2)
  • Sus scrofa
  • Toxoplasma gondii
  • Xenopus laevis
  • Yarrowia lipolytica
  • Zea mays

If you do not see your specific organism, contact customersupport@twistbioscience.com

Currently, we are unable to synthesize genes that score as Impossible. There are several factors that cause our algorithm to score a gene Impossible and the specific parameters are unique to the gene sequence. Our algorithm is proprietary and was developed using machine learning. In addition to machine learning, our algorithm does take into consideration the following factors:

  • %GC between 25-65%
  • Max homopolymer length < 10
  • Low homology

A unique combination of the above is a reflection of the specific gene sequence score of Impossible.

To maintain wild-type protein expression:

  • We avoid using rare codons (those with a codon frequency of <8%).
  • We ensure sequences do not have strong hairpins (ΔG < -8) in the first 48 base pairs of resulting sequences.
  • We check both strands to ensure they don’t contain the enzyme cut sites you asked us to avoid.
  • We avoid introducing promoter sequences internal to expression sequences by avoiding the creation of strong sigma70 binding sites.
  • We avoid sequences that create strong ribosome binding sites (GGAGG and TAAGGAG).
  • We avoid sequences that create terminator sequences (TTTTT or AAAAA).

To improve the likelihood of successful manufacture:

  • We won’t introduce any repeat longer than 20 base pairs.
  • We avoid homopolymer runs of 10 or more bases.
  • We avoid fitted sequences that create global GC% of less than 25% or more than 65% and local GC windows (50 bp) of less than 35% or more than 65%.

Please note that codon optimization is useful for improving chances of a successful synthesis, not protein expression.  

Sequence Design

Synthesis issues are driven mainly by repetitive structures, extreme GC content, and homopolymers. We use a machine learning method to determine the chance of success. Therefore, most of the time, there is no single reason for the rejection of a sequence. Rather, complexity or rejection stem from a combination of features that push a sequence into a given bucket of complexity. The only hard rules are the following:

  • Avoid homopolymers >= 14bp

  • Do not include CcdB (Type II Toxin-antitoxin system)

Should you encounter an issue, we recommend removing or minimizing repeats, regions of extreme GC content, and homopolymers. We will highlight regions of concern if your sequence is complex, unbuildable, or contains sequences which conflict with our internal processes.

After submitting your gene sequences on our website, they will be automatically scored for feasibility of assembly:

Standard: No errors have been found. Gene sequence found to be of "standard" overall complexity (e.g. length, GC content, homology, etc). 

Complex: No errors have been found. Some sequence complexities (e.g. length, GC content, homology, etc) exist but we do not expect any problems synthesizing your gene. Rarely, sequences may experience increased turnaround time or risk of manufacturing failure.

Error: Gene sequence contains errors. Please click on the sequence to get more details on how to resolve them.

Not Accepted: The sequence contains elements that make it impossible for us to synthesize. Please see the detailed explanations provided with the error message or refer to the “Design Guidelines”.

About Scoring System

Our scoring system adopts a machine learning model which analyzes and combines multiple sequence parameters ( i.e. overall GC percent, maximum homopolymer length, maximum repeat length, sequence length, repeat density, etc.). This model was trained using our historical manufacturing data, and it provides a more precise estimation of production success for genes and antibody products

About ISSUE messages

Warnings: Are associated with the risk of failure, predicted by the machine learning model. A higher number of warnings is more likely to result in a “Not Accepted” score.

Errors: Are not associated with gene complexity, and they can be fixed by correcting the gene design

Our website will accept amino acid sequences and convert them to a DNA sequence for synthesis.  At the upload sequences page, select the Amino Acid Sequence option.


 Make sure your input only contains Amino Acid one-letter characters.  We support only the standard 20 one-letter code characters.

A "*" at the end of your amino acid sequences marks a stop codon (we do not add stop codons automatically).

Based on the Codon Usage Table you choose, the most frequently used codons will be selected.            

If you do not see your specific organism, contact customersupport@twistbioscience.com for help.

Note for Clonal Genes: Not all Twist expression vectors contain standard expression machinery upstream of the insertion point. We recommend double-checking the sequence of your final plasmid construct by clicking "Download Sequences"after selecting your desired vector. 

Customers have the option of ordering oligo pools, gene fragments, and clonal genes.

Oligonucleotides (linear single-stranded DNAs) in an oligo pool can range in size from 20 bp to 300 bp.

Gene fragments are linear double-stranded DNAs that can range in size between 300 bp and 5,000 bp in length.

Clonal genes are double-stranded DNAs that have been cloned into one of Twist’s vectors or a customer-provided custom vector. Clonal genes can range in size between 300 bp and 5,000 bp in length.

* This tool is therefore provided strictly for illustrative purposes and the stated benefits, support, benefit calculations, and other results are estimates only.

**Comparison to competitor’s publicly listed pricing as of July 12, 2024. Turnaround times between Twist and competitors may vary.

Testimonials

We at Clariant onboarded a variety of our internal vectors for various host organisms at Twist Bioscience. We make use of Twist Bioscience's high success rate and fast turnover times of gene synthesis and custom cloning. Our goal is to outsource most of our routine molecular biology work to focus our research force and speed up our development times.

Dr. HELGE JOCHENS

Clariant

The quality has been excellent, and I find that cloning with these genes is successful more often on the first time than with DNA fragments from other companies.

DR. AMANDA PORTILLO

Institute of Systems and Synthetic Biology

This is where we came to really like the online ordering portal, that tells you then and there whether Twist can make your gene. We input our sequences and Twist’s algorithms right away said “yes, why not?”. It turned out that for Twist, making these difficult sequences was easy.

DR. PHILIPPE MARLIERE

Institute of Systems and Synthetic Biology

TCRlib Logo

Ordering online just got easier. Watch our “How to” video to see how to order genes all online from our eCommerce platform.