Are adapter sequences appended onto the ends of my sequences?

For Adapter-On Gene Fragments, universal adapters are synthesized onto the ends of each fragment. The adapters are 21-22 nucleotides in length. Fragments with these adapters are compatible with a number of assembly methods, namely Restriction Digestion/Ligation, Gateway, Golden Gate, and TOPO cloning.

The addition of restriction sites inside of the adapters can be used to remove adapters. TOPO cloning will work but will leave the adapters on. https://lh4.googleusercontent.com/0UpYZULAPAEvsaiWB5Fs8XTgvijkZeAMm9wLjMpzYKXHbFhLIurktZ1dvkbTuFwaOWEljBYu637HnJyw_SnFI7Cxkm2969-LWj67yycQ27_VXIFHwcMBANxi9lX9V2EqGoTDYesN

ADAPTERS SEQUENCE

5' Adapter - GAAGTGCCATTCCGCCTGACCT

3' Adapter - AGGCTAGGTGGAGGCTCAGTG

For Adapter-Off Gene Fragments and Clonal Genes, no adapters are appended onto the ends.

 

Was this article helpful?

No

Still have questions? Contact Us