Are adapter sequences appended onto the ends of my sequences?

For Adapter-On Gene Fragments, universal adapters are synthesized onto the ends of each fragment. The adapters are 21-22 nucleotides in length. Fragments with these adapters are compatible with a number of assembly methods, namely Restriction Digestion/Ligation, Gateway, Golden Gate, and TOPO cloning.

The addition of restriction sites inside of the adapters can be used to remove adapters. TOPO cloning will work but will leave the adapters on. 

 

ADAPTER SEQUENCES

For orders received before August 9, 2021, the adapter sequences are as follows: 5' Adapter: GAAGTGCCATTCCGCCTGACCT 3' Adapter: AGGCTAGGTGGAGGCTCAGTG

5’ – GAAGTGCCATTCCGCCTGACCT – insert – AGGCTAGGTGGAGGCTCAGTG – 3’ 3’ – CTTCACGGTAAGGCGGACTGGA – insert – TCCGATCCACCTCCGAGTCAC – 5'

 

For orders received after August 9, 2021, the adapter sequences are as follows: 5' Adapter: CCCCGTCACCTTTGGCTTATCAGT 3' Adapter: AGTGACATCTGGACGCTAAGACCG

5’ - CCCCGTCACCTTTGGCTTATCAGT – insert – AGTGACATCTGGACGCTAAGACCG - 3’ 3’ - GGGGCAGTGGAAACCGAATAGTCA – insert – TCACTGTAGACCTGCGATTCTGGC - 5’

*Adapters are short sequences added to each end of the insert as part of our synthesis process. Gene fragments without these adapters are also available during the checkout process.

 

Was this article helpful?

No

Still have questions? Contact Us