What are the adapter sequences used on the Adapter-On Gene Fragments?

For orders received before August 9, 2021, the adapter sequences are as follows: 5' Adapter: GAAGTGCCATTCCGCCTGACCT 3' Adapter: AGGCTAGGTGGAGGCTCAGTG

5’ – GAAGTGCCATTCCGCCTGACCT – insert – AGGCTAGGTGGAGGCTCAGTG – 3’ 3’ – CTTCACGGTAAGGCGGACTGGA – insert – TCCGATCCACCTCCGAGTCAC – 5'

 

For orders received after August 9, 2021, the adapter sequences are as follows: 5' Adapter: CCCCGTCACCTTTGGCTTATCAGT 3' Adapter: AGTGACATCTGGACGCTAAGACCG

5’ - CCCCGTCACCTTTGGCTTATCAGT – insert – AGTGACATCTGGACGCTAAGACCG - 3’ 3’ - GGGGCAGTGGAAACCGAATAGTCA – insert – TCACTGTAGACCTGCGATTCTGGC - 5’

*Adapters are short sequences added to each end of the insert as part of our synthesis process. Gene fragments without these adapters are also available during the checkout process.

 

Was this article helpful?

No

Still have questions? Contact Us