What are the adapter sequences used on the Adapter-On Gene Fragments?
The adapter sequences are as follows:
5' Adapter – GAAGTGCCATTCCGCCTGACCT
3' Adapter - AGGCTAGGTGGAGGCTCAGTG
Was this article helpful?
Yes
No
Still have questions? Contact Us
Gene Synthesis
How It Works
close menu
- Where can I find an SDS for gene products?
- What is the shelf life of Gene Fragments and Clonal Genes?
- How does Twist test the quality of the gene synthesis?
- Can I get a glycerol stock of my clonal gene?
- How should I resuspend my genes?
- What methods can I use to clone my adapter-on gene fragments?
- Are adapter sequences appended onto the ends of my sequences?
- Are Gene Fragments purified?
- What is the Turn Around Time (TAT) for gene synthesis?
- Can Twist provide cloned products?
- How do I find out the arrangement of my genes in your 96-well plate?
- Do you provide data from your NGS verification of clonal genes?
- Does Twist offer plant expression vectors?
- What are the adapter sequences used on the Adapter-On Gene Fragments?
- What is the difference between Twist's Clonal Genes and Gene Fragments?
